View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3890_high_12 (Length: 386)
Name: NF3890_high_12
Description: NF3890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3890_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 350; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 13 - 370
Target Start/End: Complemental strand, 30342746 - 30342389
Alignment:
| Q |
13 |
atggaatttttggatttaagtttcaatctttttggtaattttggtgtcccattgttcttaggagaaatccccggattgaaagaagtttatttaagtggga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30342746 |
atggaatttttggatttaagtttcaatctttatggtaattttggtgtccctttgttcttaggagaaatccccggattgaaagaagtttatttaagtggga |
30342647 |
T |
|
| Q |
113 |
atttactttctggtaaaattccagaaatatggaaaaatcttggtgctgttgaaaaaattggattttctaaaatggggttggttggtaaaattccagtttc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30342646 |
atttactttctggtaaaattccagaaatatggaaaaatcttggtgctgttgaaaaaattggattttctaaaatggggttggttggtaaaattccagtttc |
30342547 |
T |
|
| Q |
213 |
aatgggggtttatttgaagaatttatcttatcttggacttgataacaataagcttgatgggtctgttcctaaggaatttgggcttttggaatttgctaat |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30342546 |
aatgggggtttatttgaagaatttatcttatcttggacttgataacaataagcttgatgggtctgttcctaaggaatttgggcttttggaatttgctaat |
30342447 |
T |
|
| Q |
313 |
gagatcaatttggagaacaacaatttgagtggtagaatcactttctcaactagagttg |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30342446 |
gagatcaatttggagaacaacaatttgagtggtagaatcactttctcaactagagttg |
30342389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 309 - 370
Target Start/End: Original strand, 30333362 - 30333423
Alignment:
| Q |
309 |
taatgagatcaatttggagaacaacaatttgagtggtagaatcactttctcaactagagttg |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||| |
|
|
| T |
30333362 |
taatgagatcaatttggagaacaacaatttgagtggtataatcactttctcagccagagttg |
30333423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University