View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3890_high_16 (Length: 327)
Name: NF3890_high_16
Description: NF3890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3890_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 16 - 324
Target Start/End: Complemental strand, 16259585 - 16259277
Alignment:
| Q |
16 |
caataggttggatcagggtcaagaatatgaagacatttccctttaatatttttgtattcatgtgcgtaatagttaacgcaattttcattgcaacagttta |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16259585 |
caataggttggatcagggtcaaggatatgaagacatttccctttaatatttttgtattcatgtgcgtaatagttaacgcaattttcattgcaacagttta |
16259486 |
T |
|
| Q |
116 |
gatcacaattttcacaaaggccaaatccaacactgcaagttcgtattcctcgagtttttgggggtggcgtattgtaaaaacaagtgcataggttgaagta |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16259485 |
gatcacaattttcgcaaaggccaaatccaacactgcaagttcgtattcctcgagtttttgggggtggcgtattgtaaaaacaagtgcataagttgaagta |
16259386 |
T |
|
| Q |
216 |
acgacatgatccggttggacttcctggaaggttattacaatatttgaggcaatccattgctccacagttacccacaattcttgagcatgcttctactagg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16259385 |
acgacatgatccggttggacttcctggaaggttattacaatatttgaggcaatccattgctccacagttacccacaattcttgagcatgcttctactagg |
16259286 |
T |
|
| Q |
316 |
attgattgc |
324 |
Q |
| |
|
||||||||| |
|
|
| T |
16259285 |
attgattgc |
16259277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University