View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3890_high_22 (Length: 239)
Name: NF3890_high_22
Description: NF3890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3890_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 76 - 225
Target Start/End: Complemental strand, 9895068 - 9894919
Alignment:
| Q |
76 |
tcaaaattaatagaagttattataaactaattggttataaattaaaaaagagatcttcacattaagtattcatcgttagaaattttaacagtcattaact |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9895068 |
tcaaaattaatagaagttattataaactaattggttataaattaaaaaagagatcttcacattaagtattcatcgttagaaattttaacggtcattaact |
9894969 |
T |
 |
| Q |
176 |
taaaagttatgtgagtaagagaggcatctatatttgctttaggtggatgt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9894968 |
taaaagttatgtgagtaagagaggcatctatatttgctttaggtggatgt |
9894919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University