View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3890_high_25 (Length: 226)
Name: NF3890_high_25
Description: NF3890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3890_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 43486577 - 43486382
Alignment:
| Q |
1 |
gatgcacttgcatccctggattttaaaattacttttataatcttacannnnnnnn---aatactttgaatctcctaaaatgttaacaagtgtctatgaga |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
43486577 |
gatgcacttgcatccctggattttaaaattacttttataatcttacatttttttttttaatactttaaatctcctaaaatattaacaagtgtctatgaga |
43486478 |
T |
 |
| Q |
98 |
cactagttnnnnnnncaaatataaataatttggaacttgtgtaatcactcttaaaagtgtatgtatagtttaagtagtgttaattaagttagcatg |
193 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43486477 |
cactagttaaataaacaaatataaataatttggaacttgtgtaatcacttttaaaagtgtatgtatagtttaagtagtgttaattaagttagcatg |
43486382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University