View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3890_high_26 (Length: 223)
Name: NF3890_high_26
Description: NF3890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3890_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 32452175 - 32452360
Alignment:
| Q |
1 |
aggttattgccattctaaacttcaaccatagtcttcacttattgataatgctataacttattgacatcttaagaactatgattgctcaactggcctatcc |
100 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32452175 |
aggttattgtcattctaaacttcagccatagtcttcacttattgataatgctataacttattgacatcttaagaactatgattgctcagctggcctatcc |
32452274 |
T |
 |
| Q |
101 |
cattaaattgtcatgataataatctgctaaagaaggaaattgggacaaaaaacatggtgataattatattgcattgacgttgaccaa |
187 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32452275 |
tattaaa-tgtcatgataataatctgctaaagaaggaaattgggacaaaaaacatggtgataattatattgcattgacgttgaccaa |
32452360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University