View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3890_high_27 (Length: 204)
Name: NF3890_high_27
Description: NF3890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3890_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 4482986 - 4482796
Alignment:
| Q |
1 |
atcacccttcacttttctaagtgtttaataaaaaccttagacttttgctaacatatcatgtgtctattacctaatgcaggtggtcacattaacccagcag |
100 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4482986 |
atcacgcttcacttttcaaagtgtttaataaaa-ccttagacttttgctaacatatcatgtgtctattacctaatgcaggtggtcacattaacccagcag |
4482888 |
T |
 |
| Q |
101 |
tgacatttggacttttcttggcacgcaagctatctctaacaaggacattgttctacataattatgcaatgtttgggtgctatctgtgctgct |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
4482887 |
tgacatttggacttttcttggcacgcaagctatctctaacaaggacattgttctacataattatgcaatgtttgggtgctatttgtggtgct |
4482796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 78 - 110
Target Start/End: Original strand, 42796311 - 42796343
Alignment:
| Q |
78 |
aggtggtcacattaacccagcagtgacatttgg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42796311 |
aggtggtcacattaacccagcagtgacatttgg |
42796343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University