View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3890_low_23 (Length: 316)
Name: NF3890_low_23
Description: NF3890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3890_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 19 - 303
Target Start/End: Complemental strand, 4441015 - 4440729
Alignment:
| Q |
19 |
catctaaccaagattctatgattgattttcaggtagccctatgtcat--gcaccgtgtcagcatttgcttaactagattgggaaatacatcacatatgtt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4441015 |
catctaaccaagattctatgattgattttcaggtagccctatgtcatatgcaccgtgtcagcatttgcttaactagattggaaaatacatcacatatgtt |
4440916 |
T |
|
| Q |
117 |
tgcaaaattttctaagcgcacaccaattgaaatttgaacattttgtcgagctatctaaaacacatgagaccttaagctctacagttagcatatacaaaaa |
216 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4440915 |
tacaaaattttctaagcgcacaccaattgaaatttgaacattttgtcgagctatctaaaacacatgagaccttaagctctacagttagcatatacaaaaa |
4440816 |
T |
|
| Q |
217 |
agtcaaagacacaccaattaggaagaatgcgtcgtagatagagacaacatcctcatctaatcactagctgattgcacaccgccagta |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4440815 |
agtcaaagacacaccaattaggaagaatgcgtcatagatagagacaacatcctcatctaatcactagctgattgcacaccgccagta |
4440729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University