View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3890_low_24 (Length: 260)
Name: NF3890_low_24
Description: NF3890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3890_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 4440669 - 4440416
Alignment:
| Q |
1 |
acttataacaggcctgaatttgttgaatttaattagtctaaagaattagataggatgttaattgttcctggcacaatagcattggcaacaagagaagcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4440669 |
acttataacaggcctgaatttgttgaatttaatttgtctaaagaattagataggatgttaattattcctggcacaatagcattggcaacaagagaagcaa |
4440570 |
T |
 |
| Q |
101 |
tagtcctacaaagttccaatagggtggagaaatgcattgctttccaatgttcctcaaatgattctcaaatgaagggacttgcctcctaagcatggcagtg |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4440569 |
taatcctacaaagttccaatagggtggagaaatgcattgctttccaatgttcctcaaatgattctcaaatgaagggacttgcctcctaagcatggcagtg |
4440470 |
T |
 |
| Q |
201 |
tggtacatagaagttttctgctaatattgatgtgtttgtggtcgttcatctcac |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4440469 |
tggtacatagaagttttctgctaatattgatgtgtttgtggtcgttcatgtcac |
4440416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University