View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3890_low_26 (Length: 250)
Name: NF3890_low_26
Description: NF3890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3890_low_26 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 32452719 - 32452480
Alignment:
| Q |
12 |
agagattatatgatgaagattacatgcagctgaagttacttggctataaattataacttatgatttcaacaaatagcaaaaatataaaggactataatat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
32452719 |
agagattatatgatgaagattacatgcagctgaagttacttggctataaattataacttacgatttcaacaaatagcaaaaataaaaaggactataatgt |
32452620 |
T |
|
| Q |
112 |
gcattcacataagagagtctaggtgaac-aaaaacaccaatnnnnnnnnngtgaacctcaatgcaatttgattaccaacatatgatttggtccaatctcc |
210 |
Q |
| |
|
||||| |||||| ||||||||||| ||| ||||| |||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32452619 |
gcattaacataaaagagtctaggtaaactaaaaaaaccaataaaaaaaaagtgaacctcaatgcaatttgattaccaacatgtgatttggtccaatctcc |
32452520 |
T |
|
| Q |
211 |
ttttttatttatcagatcactaccatgacatttcacatgc |
250 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32452519 |
ttttttatttatgagatcactaccatgacatttcacatgc |
32452480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University