View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3890_low_28 (Length: 242)
Name: NF3890_low_28
Description: NF3890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3890_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 27798578 - 27798804
Alignment:
| Q |
1 |
taattaactcattcactcaagcaaacaatgtaaccaaaatttatgttttggtttttaaactgannnnnnnnn-agtttgaggagattgataatgttacat |
99 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27798578 |
taattaactcattcactcaaacaaacaatgtaaccaaaatttatgttttggtttttaaactgattttttttttagtttgaggagattgataatgttacat |
27798677 |
T |
|
| Q |
100 |
gctagtttttatgggtgtgtgtgtacttgtgaatgtgacttgggggactagttgtagttgtctcatccttgagttcattgggattattaggtgaaacatg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27798678 |
gctagtttttatgggtgtgtgtgtacttgtgaatgtgacttgggggactagttgtagttgtctcatccttgagttcattgggattattaggtgaaacatg |
27798777 |
T |
|
| Q |
200 |
tgtttgtggtttcattgcacatgttac |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
27798778 |
tgtttgtggtttcattgcacatgttac |
27798804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University