View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3890_low_30 (Length: 238)

Name: NF3890_low_30
Description: NF3890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3890_low_30
NF3890_low_30
[»] chr3 (1 HSPs)
chr3 (44-151)||(23034613-23034720)


Alignment Details
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 44 - 151
Target Start/End: Original strand, 23034613 - 23034720
Alignment:
44 caaaattgactcgaagatactggcagatgctattgttctagagcagattgtatttctgagttacatgttatcatacctgagattataagtaatttaaatt 143  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| ||||||| | ||||||||||||||| ||||||||    
23034613 caaaattgactcgaagatactggcggatgctattgttctagagcagattgtatttctgaattacacgttatcacagctgagattataagtattttaaatt 23034712  T
144 caaattac 151  Q
    ||||||||    
23034713 caaattac 23034720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University