View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3890_low_30 (Length: 238)
Name: NF3890_low_30
Description: NF3890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3890_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 44 - 151
Target Start/End: Original strand, 23034613 - 23034720
Alignment:
| Q |
44 |
caaaattgactcgaagatactggcagatgctattgttctagagcagattgtatttctgagttacatgttatcatacctgagattataagtaatttaaatt |
143 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| ||||||| | ||||||||||||||| |||||||| |
|
|
| T |
23034613 |
caaaattgactcgaagatactggcggatgctattgttctagagcagattgtatttctgaattacacgttatcacagctgagattataagtattttaaatt |
23034712 |
T |
 |
| Q |
144 |
caaattac |
151 |
Q |
| |
|
|||||||| |
|
|
| T |
23034713 |
caaattac |
23034720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University