View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3890_low_31 (Length: 236)
Name: NF3890_low_31
Description: NF3890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3890_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 105 - 222
Target Start/End: Original strand, 36838358 - 36838475
Alignment:
| Q |
105 |
cctgaaccatatccagaagctaacttggagtttctcaagtcaaatgggatcaagctttatcactttgggattgagggtcataaggtgtgtgtatatctat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36838358 |
cctgaaccatatccagaagctaacttggagtttctcaagtcaaatgggatcaagctttatcactttgggattgagggtcataaggtgtgtgtatatctat |
36838457 |
T |
 |
| Q |
205 |
cagtatatatgttttatg |
222 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36838458 |
aagtatatatgttttatg |
36838475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University