View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3891_high_17 (Length: 225)
Name: NF3891_high_17
Description: NF3891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3891_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 7893666 - 7893714
Alignment:
| Q |
1 |
caagcacaaatgccacttattcatgtcaatcaactgtatgatgcaataa |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7893666 |
caagcacaaatgccacttattcatgtcaatcaactgtatgatgcaataa |
7893714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 172
Target Start/End: Complemental strand, 24079202 - 24079136
Alignment:
| Q |
104 |
ttgaaaccaagcatcttgttagaacataaatctgcatttattttttaccacttccatgtattacattgt |
172 |
Q |
| |
|
||||||| ||||||||||||||||| |||| ||||||| | || |||||||||||||||||||||||| |
|
|
| T |
24079202 |
ttgaaactaagcatcttgttagaacttaaacctgcattga--ttctaccacttccatgtattacattgt |
24079136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 51
Target Start/End: Complemental strand, 24079258 - 24079214
Alignment:
| Q |
7 |
caaatgccacttattcatgtcaatcaactgtatgatgcaataata |
51 |
Q |
| |
|
|||||| ||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
24079258 |
caaatgacacttattcatctgaatcaactgtatgatgcaataata |
24079214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University