View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892-Insertion-16 (Length: 198)
Name: NF3892-Insertion-16
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892-Insertion-16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 8 - 198
Target Start/End: Complemental strand, 972362 - 972173
Alignment:
| Q |
8 |
tgaccatgtcttacaatctgtcccaactcgaacgtaaagggggctgggacaaggacataaaatatggaataggagatgaacataactgaaacagtgatcg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
972362 |
tgaccatgtcttacaatctgtcccaactcgaacgtaatgggggctgggacaaggacataaaatatggaataggagatgaacataactgaaacagtgatcg |
972263 |
T |
 |
| Q |
108 |
ggttcggattaaccctcgggttacccgccccgtcccaattttatttgtggtcaaaatgttttttgtaatattattttacacattctctccg |
198 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
972262 |
ggttcggattaaccctcgggttacccgtcccgtcccaattttatttgtggacaaaatggttttt-taatattattttacacattctctccg |
972173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University