View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892-Insertion-17 (Length: 128)
Name: NF3892-Insertion-17
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892-Insertion-17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 4e-45; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 4e-45
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 1373119 - 1373000
Alignment:
| Q |
8 |
aatgatgcggcgtggacctgaagggccaagaaccctctgcaatgcttgtggacttatgtcggcaaacaaggtaaatgggaactgtgttaattcctcatgt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
1373119 |
aatgatgcggcgtggacctgaagggccaagaaccctctgcaatgcttgtggacttatgtgggcaaataaggtaaatgggaactatgttaattattcatgt |
1373020 |
T |
|
| Q |
108 |
caattgctatctttttgttt |
127 |
Q |
| |
|
|||||| |||| |||||||| |
|
|
| T |
1373019 |
caattgttatccttttgttt |
1373000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 1e-23
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 1384928 - 1384869
Alignment:
| Q |
8 |
aatgatgcggcgtggacctgaagggccaagaaccctctgcaatgcttgtggacttatgtc |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1384928 |
aatgatgcggcgtggacctgaagggccaagaaccctctgcaatgcttgtggactcatgtc |
1384869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 101 - 128
Target Start/End: Complemental strand, 1384876 - 1384849
Alignment:
| Q |
101 |
ctcatgtcaattgctatctttttgttta |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
1384876 |
ctcatgtcaattgctatctttttgttta |
1384849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University