View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892-Insertion-23 (Length: 75)
Name: NF3892-Insertion-23
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892-Insertion-23 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 62; Significance: 2e-27; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 10 - 75
Target Start/End: Complemental strand, 4039073 - 4039008
Alignment:
| Q |
10 |
ttctccatatgcatccacttgttgttgcatctcctgacgatcctgatcattggctcgttgttgctc |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4039073 |
ttctccatatgcatccacttgttgttgcatctcctgacgatcgtgatcattggctcgttgttgctc |
4039008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University