View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892-Insertion-9 (Length: 191)
Name: NF3892-Insertion-9
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892-Insertion-9 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 8e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 8e-63
Query Start/End: Original strand, 11 - 191
Target Start/End: Original strand, 30388086 - 30388266
Alignment:
| Q |
11 |
aattcacctaaattacatagaaaatgctttaaaaacatttccttaaatcaaaattaaaaaccatagtacttatccaagtattgtctactagtgacatgnn |
110 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30388086 |
aattcacctaaatcacatagaaaaggctttaaaaacatttccttaaatcaaaattaaaaaccatagtacttatccaagtattgtctactagtgacatgaa |
30388185 |
T |
 |
| Q |
111 |
nnnnnnnnnnnnnnnttgggatcttaatcttggataaggattaaaagtccaatcccttaagaaagaaacagtatcaccaag |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30388186 |
aatgaaaaataaaaattgggatcttaatcttggataaggattaaaagtccaatcccttaagaaagaaacagtatcaccaag |
30388266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University