View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_high_117 (Length: 242)
Name: NF3892_high_117
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_high_117 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 14 - 171
Target Start/End: Original strand, 39504550 - 39504707
Alignment:
| Q |
14 |
aagcaaaggcggaagacagagggttttcatagtaaaacaaggatgaggaagaaacttaagtggtcggttaagatcataaaactgttgtctgtcttcaatt |
113 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39504550 |
aagcaacggcggaagacagagggttttcatagtaaaacaaggatgaggaagaaacttaagtggtcggttaagatcataaaattgttgtctgtcttcaatt |
39504649 |
T |
 |
| Q |
114 |
taactataaatagcatttaaggttgttggtgataatgaggtaagccttcactaccaaa |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39504650 |
taactataaatagcatttaaggttgttggtgataatgaggtaagccttcactaccaaa |
39504707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 190 - 225
Target Start/End: Original strand, 39504726 - 39504761
Alignment:
| Q |
190 |
gagaggtacctaacttaaagtgagtccatgactatg |
225 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39504726 |
gagtggtacctaacttaaagtgagtccatgactatg |
39504761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University