View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3892_high_133 (Length: 234)

Name: NF3892_high_133
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3892_high_133
NF3892_high_133
[»] chr5 (2 HSPs)
chr5 (156-221)||(16591351-16591417)
chr5 (1-30)||(16591480-16591509)


Alignment Details
Target: chr5 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 156 - 221
Target Start/End: Complemental strand, 16591417 - 16591351
Alignment:
156 atcacaccaaaatgactaagaatttagactcacacatgcagat-cttgcctgaattgaagaatgatg 221  Q
    |||||||||||||||||||||||||||||||||||||||||||  |||||||| |||||||||||||    
16591417 atcacaccaaaatgactaagaatttagactcacacatgcagatatttgcctgagttgaagaatgatg 16591351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 16591509 - 16591480
Alignment:
1 tagaaattgagagtgaagatgcaaatcttc 30  Q
    ||||||||||||||||||||||||||||||    
16591509 tagaaattgagagtgaagatgcaaatcttc 16591480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University