View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_high_133 (Length: 234)
Name: NF3892_high_133
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_high_133 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 156 - 221
Target Start/End: Complemental strand, 16591417 - 16591351
Alignment:
| Q |
156 |
atcacaccaaaatgactaagaatttagactcacacatgcagat-cttgcctgaattgaagaatgatg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
16591417 |
atcacaccaaaatgactaagaatttagactcacacatgcagatatttgcctgagttgaagaatgatg |
16591351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 16591509 - 16591480
Alignment:
| Q |
1 |
tagaaattgagagtgaagatgcaaatcttc |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16591509 |
tagaaattgagagtgaagatgcaaatcttc |
16591480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University