View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_high_137 (Length: 230)
Name: NF3892_high_137
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_high_137 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 14 - 230
Target Start/End: Original strand, 38275482 - 38275692
Alignment:
| Q |
14 |
aggagagcctttggcgataaataagaaattgaatattctgcaatgtgatcacaggtttcacatataaaagaccccatacaagtgcagatgcagatcttga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38275482 |
aggagagcctttggcgataaataagaaattgaatattctgcaatgtgatcacaggtttcacatataaaagaccccatacaagtgca------gatcttga |
38275575 |
T |
|
| Q |
114 |
agtaattttatccctttctcatcacagtaacgctgaaaaagttcccttgtatcttgcagtgccttcgacttgaaaaacatacggtgtgaagattaatact |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38275576 |
agtaattttatccctttctcatcacagtaacgctgaaaaagttcccttgtatcttgcagtgccttcgacttgaaaaacatacggtgtgaagattaatact |
38275675 |
T |
|
| Q |
214 |
aacaaagttttgtttac |
230 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38275676 |
aacaaagttttgtttac |
38275692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 112 - 177
Target Start/End: Original strand, 8964798 - 8964863
Alignment:
| Q |
112 |
gaagtaattttatccctttctcatcacagtaacgctgaaaaagttcccttgtatcttgcagtgcct |
177 |
Q |
| |
|
|||||||||| |||| |||||||||| |||||| ||||||||||||| |||| |||||| |||||| |
|
|
| T |
8964798 |
gaagtaatttcatccttttctcatcagagtaacactgaaaaagttcctttgtctcttgcggtgcct |
8964863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University