View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_high_52 (Length: 349)
Name: NF3892_high_52
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_high_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 207 - 333
Target Start/End: Complemental strand, 36947600 - 36947474
Alignment:
| Q |
207 |
atctgcaggctaggccctctgagagactagaagacatcgctttaaaatttttgcaatacaaggtggcagtagttgctattatgcattcttcttccgaggg |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36947600 |
atctgcaggctaggccctctgagagactagaagacatcgttttaaaatttttgcaatacaaggtggcagtagttgctattatgcattcttcttccgaggg |
36947501 |
T |
|
| Q |
307 |
cgggtcaactcctcagctgctacatat |
333 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
36947500 |
cgggtcaactcctcagctgctacatat |
36947474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 36947806 - 36947654
Alignment:
| Q |
1 |
atactttagcagcatgcatagagagaaaattacagcaatgtggaactgatagtaatgggaaaacatatccttcgagttttgttgatgtaagctctttaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | ||| |
|
|
| T |
36947806 |
atactttagcagcatgcatagagagaaaattacagcaatgtggaactgatagtaatgggaaaacatatccttggagttttgttgatgtaagctcctcaac |
36947707 |
T |
|
| Q |
101 |
acttgtgcgaaattttttgcgtatcaaatcaatttcccaatttcgcgtagaaa |
153 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
36947706 |
acttgttagaaattttttgctcatcaaatcaatttcccaattttgcgtagaaa |
36947654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University