View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_high_65 (Length: 322)
Name: NF3892_high_65
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_high_65 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 19 - 312
Target Start/End: Complemental strand, 43109734 - 43109441
Alignment:
| Q |
19 |
ttttcaggtcttgcagttgtggagttggaattccaccaccgtgtctatgtagctagagctgaaaagtcatggaaacaaattgcaagttccctgcagttca |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43109734 |
ttttcaggtcttgcagctgtggagttggaattccaccaccgtgtctatgtagctagagctgaaaagtcatggaaacaaattgcaagttccctacagttca |
43109635 |
T |
 |
| Q |
119 |
tattgggttgcaacattgagctcagaatcaaccatgttccatgtactacagattctaagtatgctaggttgaagaggtcatctttcaatttcttcaattg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43109634 |
tattgggttgcaacattgagctcagaatcaaccatgttccatgtactacagattctaagtatgctaggttgaagaggtcatctttcaatttcttcaattg |
43109535 |
T |
 |
| Q |
219 |
ttcgcgcaggattcttcggaaatcattatcatccgatgaacatggatgtgaatcagactatgctgattgcacttctcaaaagcctatgatgatg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43109534 |
ttcgcgcaggattcttcggaaatcattatcatccgatgaacaaggatgtgaatcagactatgctgattgcacttctcaaaagcctatgatgatg |
43109441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University