View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_high_79 (Length: 294)
Name: NF3892_high_79
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_high_79 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 258260 - 258044
Alignment:
| Q |
1 |
attgtcattgctgataatccttctttgtttgccatcttcatcactttattttctggtggtgatgactttaatgaatcctatttttcacagcacacatatg |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
258260 |
attgtcattgctgataatcctactttgtttgccatcttcatcactttattttctggtggtgatgactttaatgaatcctatttttcacagcacacatatg |
258161 |
T |
 |
| Q |
101 |
attat----ttcaattaaatgaaagagaatgcaattctggttgcagtaaatacaaaaaacttctgtttgctaataacttccttttcttgtagaattttgg |
196 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
258160 |
attatatatttcaattaaatgaaagagaatgcaattctggttgcagtaaatacaaaaaacttctgtttgctaataacttctttttcttgtagaattttgg |
258061 |
T |
 |
| Q |
197 |
tctcttatctcactctt |
213 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
258060 |
tctcttatctcactctt |
258044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 26 - 65
Target Start/End: Complemental strand, 51542281 - 51542242
Alignment:
| Q |
26 |
tgtttgccatcttcatcactttattttctggtggtgatga |
65 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
51542281 |
tgtttgccctcttcatcactttattttctggaggtgatga |
51542242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University