View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_high_95 (Length: 255)
Name: NF3892_high_95
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_high_95 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 15 - 253
Target Start/End: Original strand, 33186702 - 33186940
Alignment:
| Q |
15 |
cagagaccatgggaacaatttatagaatatagttttctccattcatatatcaattatcaaggaaggtagctagaacctacaaaaagaaaagaatggcttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33186702 |
cagagaccatgggaacaatttatagaatatagttttctccattcatatatcaattatcaaggaaggtagctagaacctacaaaaagaaaagaatggcttt |
33186801 |
T |
 |
| Q |
115 |
attttggccttaataccatatctttgtcgggtgctctatgtatttttctagcacacgaacccacaatacttttctctgccatcatttttcttatttaatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33186802 |
attttggccttaataccatatctttgtcgggtgctctatgtatttttctagcacacgaacccacaatacttttctctgccatcatttttcttatttaatt |
33186901 |
T |
 |
| Q |
215 |
ttagttttaattgttttcttccatgtcttccacataaac |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33186902 |
ttagttttaattgttttcttccatgtcttccacataaac |
33186940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University