View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_low_10 (Length: 565)
Name: NF3892_low_10
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 9e-50; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 9e-50
Query Start/End: Original strand, 45 - 165
Target Start/End: Original strand, 8466623 - 8466743
Alignment:
| Q |
45 |
tagatatgagtgtttaataaacattgcctacgtagaaaacttaaaagttgctgagtattgaaatgtcaccgttcatctcaaagaatgaactttccctgag |
144 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
8466623 |
tagatatgaatgtttaataaacattacctacgtagaaaacttaaaagttgttgagtattgaaatgtcaccggtcatctcaaagaatgaacttttcctgag |
8466722 |
T |
 |
| Q |
145 |
ttaagatgctcagataaatta |
165 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
8466723 |
ttaagatgctcagataaatta |
8466743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 399 - 496
Target Start/End: Original strand, 8467399 - 8467496
Alignment:
| Q |
399 |
tgcagcattagcttttctacccctcttattagtagtagacttaatggacttgctcttcttattcacaaccttcttcttaccaccaaccgttccatttg |
496 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8467399 |
tgcagcattagcttttctacccctcttattagtagtagacttaatggacttgctcttcttattcacaaccttcttcttaccaccaaccgttgcatttg |
8467496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 290 - 369
Target Start/End: Original strand, 8467320 - 8467399
Alignment:
| Q |
290 |
tagctgcgagtactacaaagagacttcaggccaaaaaacagttatcatattcacacatactatattacatagtttcagtt |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467320 |
tagctgcgagtactacaaagagacttcaggccaaaaaacagttatcatattcacacatactatattacatagtttcagtt |
8467399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 196 - 274
Target Start/End: Original strand, 8467198 - 8467276
Alignment:
| Q |
196 |
attagtccgcacattctcaatgatacaggaaattcatcccacaatttaaatcagaacaaaaatagcaaaaggatgtctc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467198 |
attagtccgcacattctcaatgatacagaaaattcatcccacaatttaaatcagaacaaaaatagcaaaaggatgtctc |
8467276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 14 - 51
Target Start/End: Original strand, 8465043 - 8465080
Alignment:
| Q |
14 |
cctttttcttcctttctctcgatgtgtagaatagatat |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8465043 |
cctttttcttcctttctctcgatgtgtagaatagatat |
8465080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 161 - 199
Target Start/End: Original strand, 8467152 - 8467190
Alignment:
| Q |
161 |
aattattaatacatgcactttgattgtcacagtgaatta |
199 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
8467152 |
aattattaatacttgcactttgattgtcatagtgaatta |
8467190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University