View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_low_103 (Length: 252)
Name: NF3892_low_103
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_low_103 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 28677714 - 28677473
Alignment:
| Q |
11 |
cataggtagacaaaatgaaggaatacatagattttggacaacttcaaactgattcatatttcaaacagggtagccaactgattccatatagacatagttc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28677714 |
cataggtagacaaaatgaaggaatacatagattttggacaacttcgaactgattcatatttcaaacagggtagccaactgattccatatagacatagttc |
28677615 |
T |
|
| Q |
111 |
actggaatattgctataaagttcgaccaaaagaactaattagattttatttattttattgactttatttagtatctttgctaagcatccctatattgggt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28677614 |
actggaatattgctataaagttcgaccaaaagaactaattagattttatttattttattgactttatttagtatctttgctaagcatccctatattgggt |
28677515 |
T |
|
| Q |
211 |
tttgctgtatctgcagaaaatggggaagcaagtcatcaagac |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28677514 |
tttgctgtatctgcagaaaatggggaagcaagtcatcaagac |
28677473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University