View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_low_111 (Length: 249)
Name: NF3892_low_111
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_low_111 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 11 - 166
Target Start/End: Complemental strand, 5088914 - 5088759
Alignment:
| Q |
11 |
atgaagaagtgttacttatatgtacaccaatatatatttcaatagatgaaagaattaaaatcgaagtgtttatttgttacataagttgtttgcatgcatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5088914 |
atgaagaagtgttacttatatgtacaccaacatatatttcaatagatgaaagaattcaaatcaaagtgtttatttgtaacataagttgtttgcatgcatg |
5088815 |
T |
|
| Q |
111 |
agaattttgtcttatcgtgtattattaactttatggcatcttgtaattgttgcatc |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5088814 |
agaattttgtcttatcgtgtattattaactttatggcatcttgtaattcttgcatc |
5088759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 221
Target Start/End: Complemental strand, 5088732 - 5088704
Alignment:
| Q |
193 |
tttgtaatcttgttttattataattatta |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5088732 |
tttgtaatcttgttttattataattatta |
5088704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University