View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_low_117 (Length: 243)
Name: NF3892_low_117
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_low_117 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 13 - 229
Target Start/End: Original strand, 14578632 - 14578848
Alignment:
| Q |
13 |
aagcaaaggaaaatgcaaaagatgaggatgaggaagctcaactgaaggaagaggaagaaaaggtggaggctattgaaaattcaaaggaaaatgtgaagaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14578632 |
aagcaaaggaaaatgcaaaagatgaggatgaggaagctcaactgaaggaagaggaagaaaaggtggaggctattgaaaattcaaaggaaaatgtgaagaa |
14578731 |
T |
|
| Q |
113 |
gaatggtgtcatacatgaatttggattagtataatttcagtagtatcaactacactttgaaacttattaataagacaatagtttttatattatgtaactc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14578732 |
gaatggtgtcatacatgaatttggattagtataatttcagtagtatcaactacactttgaaacttattaataagacaatagtttttatattatgtaactc |
14578831 |
T |
|
| Q |
213 |
atataagtagtttttca |
229 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
14578832 |
atataagtagtttttca |
14578848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 121
Target Start/End: Original strand, 2842996 - 2843056
Alignment:
| Q |
61 |
aagaggaagaaaaggtggaggctattgaaaattcaaaggaaaatgtgaagaagaatggtgt |
121 |
Q |
| |
|
|||||||||||||||| ||||| |||||| | | |||||||||||||| |||||||||| |
|
|
| T |
2842996 |
aagaggaagaaaaggttaaggctgatgaaaagttagaggaaaatgtgaaggagaatggtgt |
2843056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University