View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_low_119 (Length: 243)
Name: NF3892_low_119
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_low_119 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 40762721 - 40762484
Alignment:
| Q |
1 |
caatcgaaggagttttatactgcaagactcacgctgagcagcttttcaaggattccttcgccgccaagaaaccccagacgggtaataagatccnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40762721 |
caatcgaaggagttttatactgcaagactcacgctgagcagcttttcaaggattccttcgccgccaagaaaccccagacgggtaataagatccttttttt |
40762622 |
T |
 |
| Q |
101 |
nnatatacttgtctataccaa----------taggaatttaattatgtgctgtttttggggctaaataatcacttaatcttaatttgtttcatgattttc |
190 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40762621 |
t-atatacttgtctataccaaattataataataggaattta----tgtgctgtttttggggctaaataatcacttaatcttaatttgtttcatgattttc |
40762527 |
T |
 |
| Q |
191 |
aaacagcaggaaagcccagcgaactggtgtgtattctattcac |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40762526 |
aaacagcaggaaagcccagcgaactggtgtgtattctattcac |
40762484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University