View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_low_122 (Length: 239)
Name: NF3892_low_122
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_low_122 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 42338876 - 42339081
Alignment:
| Q |
19 |
tcactatcttcttaagtaagctctaaaactttcgacattgagacaaaaggagcttaacatttcaacttgcatttccaggtatatttctctccaaaacttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42338876 |
tcactatcttcttaagtaagctctaaaacttttgacattgagacaaaaggagcttaacattacaacttgcatttccaggtatatttctctccaaaagttt |
42338975 |
T |
 |
| Q |
119 |
gattcaaaggaaataatgatcttatcaatatactatttctctatattttgttatatgcatggaagctttgtgaacgtttttggtttgatttcattggatt |
218 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42338976 |
gattcaaaggaaataatgatctcatcaatatactatttctctatattttgttatatgcatggaaactttgtgaacgtttttggtttgatttcattggatt |
42339075 |
T |
 |
| Q |
219 |
acctat |
224 |
Q |
| |
|
|||||| |
|
|
| T |
42339076 |
acctat |
42339081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University