View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_low_124 (Length: 239)
Name: NF3892_low_124
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_low_124 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 7329291 - 7329512
Alignment:
| Q |
18 |
aattaaactcctctttgagtttgttgtccacatgaatttcatggttcaatttcttggttagaaactccattttttgagccacattatccgatctatcgac |
117 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7329291 |
aattaaactcatctttgagtttggtgtccacatgaatttcatggttcaatttcttggttagagactccattttttgagccacattatccgatctatcgat |
7329390 |
T |
|
| Q |
118 |
atgttctggcttaattttcgaatctatcaacattagataaaacatgtaagtaactatagttgcaactgacactatttatcttagtactagcaacatactc |
217 |
Q |
| |
|
| |||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||||| |
|
|
| T |
7329391 |
acattctggcttagttttcgaatctatcaacattagataaaatatgtaagtaactatagttgcaactgacactatttatatgactactagcaacatactc |
7329490 |
T |
|
| Q |
218 |
tccgacacccttttcgacactt |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7329491 |
tccgacacccttttcgacactt |
7329512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University