View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_low_126 (Length: 238)
Name: NF3892_low_126
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_low_126 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 119
Target Start/End: Original strand, 32937323 - 32937424
Alignment:
| Q |
18 |
gtcattggcatcgaataacacaacagatactgtacgcatagccgatcttaagaagagaagatattggtttcctttgatggtatgaattctatttattttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32937323 |
gtcattggcatcgaataacacaacagatactgtacgcatagctgatcttaagaagagaagatattggtttcctttgatggtatgaattctatttattttt |
32937422 |
T |
|
| Q |
118 |
tg |
119 |
Q |
| |
|
|| |
|
|
| T |
32937423 |
tg |
32937424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 194 - 238
Target Start/End: Original strand, 32937608 - 32937652
Alignment:
| Q |
194 |
tatgatagattgtgatttatcaacggttcaacaaatccatataac |
238 |
Q |
| |
|
|||||| |||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
32937608 |
tatgatggattctgatttatcaactgttcaacaaatccatataac |
32937652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University