View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_low_139 (Length: 230)
Name: NF3892_low_139
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_low_139 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 230
Target Start/End: Complemental strand, 54080954 - 54080733
Alignment:
| Q |
11 |
tttagagggtatgcagtgtatttgttgttgatactctgaagaggttttgaagtat--ttatagctgctgaatgctcttgttttggtgtgaacatgtggaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
54080954 |
tttagagggtatgcagtgtatttgttgttgatactctgaagaggttttgaagtatatttatagccgctgaatgctctagttttggtgtgaacatgtggaa |
54080855 |
T |
 |
| Q |
109 |
tgattattttaagtttgaggctagaaagtgggggaaatcatatttgcgtggcatatttggatttggatgaacaaaaacttgtggttgaagccccttgaac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54080854 |
tgattattttaagtttgaggctagaaagtgggggaaatcatatttgcgtggcatatttggatttggatgaacaaaaacttgtggttgaagccccttgaac |
54080755 |
T |
 |
| Q |
209 |
atgcacattcgcatgatttatg |
230 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
54080754 |
atgcacattcgcatgatttatg |
54080733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 90 - 230
Target Start/End: Complemental strand, 54084228 - 54084088
Alignment:
| Q |
90 |
ttggtgtgaacatgtggaatgattattttaagtttgaggctagaaagtgggggaaatcatatttgcgtggcatatttggatttggatgaacaaaaacttg |
189 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||| | ||| |||||||| |||||||||||||| ||||||||| | ||||||||| |
|
|
| T |
54084228 |
ttggtgtgaaaatgcggaatgattattttaagtttgaggctagaaagtagaggagatcatattggcgtggcatatttgaatttggatggataaaaacttg |
54084129 |
T |
 |
| Q |
190 |
tggttgaagccccttgaacatgcacattcgcatgatttatg |
230 |
Q |
| |
|
|||||||| | |||||||| ||| |||| |||||||||||| |
|
|
| T |
54084128 |
tggttgaaacgccttgaacttgctcattggcatgatttatg |
54084088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University