View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_low_142 (Length: 227)
Name: NF3892_low_142
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_low_142 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 46797370 - 46797590
Alignment:
| Q |
7 |
atttcgggtttggattcgcgctcaacatattaaatatatctctaacattttacggtctaaattgttttacacagacatttacattcattttatatagaag |
106 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46797370 |
atttcgggtttgaattcgcgctcaacatattaaatatatctccaacattttacggtctaaattgttttacacagacatttacattcattttatatagaag |
46797469 |
T |
|
| Q |
107 |
tatatatgctttgagtatgagtatacttttggattaagttttttgtttaaaaatataatatattagttaattttaattatgaaaaccctaaggaaaagta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46797470 |
tatatatgctttgagtatgagtatacttttggattaagttttttgtttaaaaatataatatattagttaattttaattattaaaaccctaaggaaaagta |
46797569 |
T |
|
| Q |
207 |
gtaacaaaggaaattgtagta |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46797570 |
gtaacaaaggaaattgtagta |
46797590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University