View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3892_low_144 (Length: 226)

Name: NF3892_low_144
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3892_low_144
NF3892_low_144
[»] chr3 (1 HSPs)
chr3 (17-209)||(10750455-10750647)


Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 17 - 209
Target Start/End: Original strand, 10750455 - 10750647
Alignment:
17 gcaaagggcaaaacggttgggttcttgttcgtgggccggatttgtccggtgggtctcagatcgattcggggagtggaaagttgattcgacgtcgttttgg 116  Q
    |||||||||||||||||||||||||||||||||| |||||||| || |  ||||||| ||||| |||||||| |||||||||||||||  ||||||||||    
10750455 gcaaagggcaaaacggttgggttcttgttcgtggaccggatttatcggaagggtctcggatcggttcggggaatggaaagttgattcggtgtcgttttgg 10750554  T
117 atgttgctatgtttgtcaatgctatttgcatgggagactgtggaggggctttgaacatagtatccacacgggtaggtttggtatgtcagagtt 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10750555 atgttgctatgtttgtcaatgctatttgcatgggagactgtggaggggctttgaacatagtatccacacgggtaggtttggtatgtcagagtt 10750647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University