View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3892_low_150 (Length: 208)

Name: NF3892_low_150
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3892_low_150
NF3892_low_150
[»] chr7 (1 HSPs)
chr7 (75-192)||(5834575-5834692)


Alignment Details
Target: chr7 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 75 - 192
Target Start/End: Complemental strand, 5834692 - 5834575
Alignment:
75 agagttcatggataatattgtaaattggaccgcaatatttaaacaaaggttacactctgaaccctaagcttagcagagatatactatagttgctctgcaa 174  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
5834692 agagttcatggataatattgtaaattgaaccgcaatatttaaacaaaggttacactctgaaccctaagcttagtagagatatactatagttgctctgcaa 5834593  T
175 taggagacgtagacacag 192  Q
    ||||||||||||||||||    
5834592 taggagacgtagacacag 5834575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University