View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3892_low_152 (Length: 201)

Name: NF3892_low_152
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3892_low_152
NF3892_low_152
[»] chr4 (1 HSPs)
chr4 (18-183)||(23136018-23136182)


Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 18 - 183
Target Start/End: Complemental strand, 23136182 - 23136018
Alignment:
18 ttcttacaaaaacatttggtagattgcacaccaatatgagtagcaccaagcttcactcgttccaaagccaattatttctacacaacctaattagcatcat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
23136182 ttcttacaaaaacatttggtagattgcacaccaatatgagtagcaccaagcttcactcgttccaaagccaattatttctacacaatctaattagcatcat 23136083  T
118 gaccatccaaagggaaaccccaccgtgggttttgacatttggaagcgcaaccccgcatagggtttt 183  Q
    ||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||    
23136082 gaccatccaaagggaaaccccaccgtgggttttgaca-ttggaaacgcaaccccgcatagggtttt 23136018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University