View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_low_47 (Length: 359)
Name: NF3892_low_47
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_low_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 18 - 285
Target Start/End: Original strand, 43855220 - 43855484
Alignment:
| Q |
18 |
attggcatttgctcccacaacatattttgtaagtccataaaatttattttcctttaaatatatttggagtacatgatttgatataataatgctcaacata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43855220 |
attggcatttgctcccacaacatattttgtaagtccataaaatttatttttctttaaatatatttggagtacat---ttgatataataatgctcaacata |
43855316 |
T |
 |
| Q |
118 |
atataatatgaaatataatgtgattttgtagctaccttgcattatgtggcttgctatttacaaacctaagaggtttagtttgtcttggttcaccaattgg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43855317 |
atataatatgaaatataatgtgattttgtagcttccttgcattatgtggcttgctatttacaaacctaagaggtttagcttgtcttggttcaccaattgg |
43855416 |
T |
 |
| Q |
218 |
gtatgttcaattgcatcactcttcttgttatattttattttgatatctttagaggttgaaatataaaa |
285 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43855417 |
gtatgttcaattgcatcacacttcttgttatattttattttgatatctttagaggttgaaagataaaa |
43855484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 283 - 349
Target Start/End: Original strand, 43855581 - 43855647
Alignment:
| Q |
283 |
aaacatagcttaacttattgggctacattgttttcagatttgcatcatacttggcctcctccctatg |
349 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
43855581 |
aaacataacttatcttattgggctacattgttttcagatttgcattatacttggcctcctccttatg |
43855647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University