View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_low_51 (Length: 350)
Name: NF3892_low_51
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_low_51 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 148 - 350
Target Start/End: Complemental strand, 3425650 - 3425448
Alignment:
| Q |
148 |
gatggacagtgcaaacttttgcacagaaatagagcaaggatggagaacaatgatgacataaccaggctctcataagtcataccatatttgtcttataggg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3425650 |
gatggacagtgcaaacttttgcacagaaatagagcaaggatggagaacaatgatgacataaccaggctctcataagtcataccatatttgtcttatagga |
3425551 |
T |
|
| Q |
248 |
cacaagagtgtgtatgatagctattgtagatacgctatacaagattctagctatgacagttaattatggataactaacaagataacttgctacacaagtt |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3425550 |
cacaagagtgtgtatgatagctattgtagatacgctatacaagattctagctatgacagttaattatggataactaacaagataacttgctacacaagtt |
3425451 |
T |
|
| Q |
348 |
atc |
350 |
Q |
| |
|
||| |
|
|
| T |
3425450 |
atc |
3425448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University