View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_low_70 (Length: 314)
Name: NF3892_low_70
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_low_70 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 5354594 - 5354816
Alignment:
| Q |
17 |
agttttctttcctctttcattacaattgttagacaaattaacgacataaactcggttactcaaatggccatttctcgagcttccgtaccgtccaaacaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5354594 |
agttttctttcctctttcattacaattgttagacaaattaacgacataaactcggttactcaaatggccatttctcgagcttccgtaccggccaaacaaa |
5354693 |
T |
|
| Q |
117 |
cactaaagtgccaatagaactagtttagcacacttcatatatataacttacaacttttaatcatgtcccctagaaaaacttttaatcatgtggtcaataa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
5354694 |
cactaaagtgccaatagaactagtttagcacacttcatatatataacttacaacttttaatcatgtcccctaaaaaaacttttaatcatgtggtccatgg |
5354793 |
T |
|
| Q |
217 |
catattgggtcatgctaagaaat |
239 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
5354794 |
catattgggtcatgctaacaaat |
5354816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 259 - 305
Target Start/End: Original strand, 5354844 - 5354890
Alignment:
| Q |
259 |
aatgctaataaatgtttttagaaccttaaggatattcgtttaggaat |
305 |
Q |
| |
|
|||||||| |||||||||||||||| ||| |||||||||| |||||| |
|
|
| T |
5354844 |
aatgctaacaaatgtttttagaaccctaaagatattcgttaaggaat |
5354890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University