View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_low_76 (Length: 302)
Name: NF3892_low_76
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_low_76 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 9496893 - 9496605
Alignment:
| Q |
1 |
acaccagcatatatgtatctagtaggacttaagcaacaatctttcttacatgttcctggtcacgtgctatctgtgacattgcaatcaggcggtcctgcag |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496893 |
acaccaacatatatgtatctagtaggacttaagcaacaatctttcttacatgttcctggtcacgtgctatctgtgacattgcaatcaggcggtcctgcag |
9496794 |
T |
 |
| Q |
101 |
caaggcagcaggtaaaggttggatcagaggctgtactgcaatgtttttacctctccaagaaggccacacaacttcagcaccatccattcttaaacaacca |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496793 |
caaggcagcaggtaaaggttgaatcagaggctgtactgcaatgtttttacctctccaagaaggccacacaacttcagcaccatccattcttaaacaacca |
9496694 |
T |
 |
| Q |
201 |
tcctctaaattacttccatcatgataccagcctctcattccccagtgtcttgggctggaactaccagacctaacagttggaaaacccct |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496693 |
tcctctaaattacttccatcatgataccagcctctcattccccagtgtcttgggctggaactaccagacctaacagttggaaaacccct |
9496605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University