View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_low_77 (Length: 302)
Name: NF3892_low_77
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_low_77 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 13 - 287
Target Start/End: Complemental strand, 32915154 - 32914880
Alignment:
| Q |
13 |
atactaactaacagcaagaaaagaaccgaagaacatgacaaaggtggttgtataaattattattgtttgttttattcctttgttcctttgtttgtttagg |
112 |
Q |
| |
|
||||||| |||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
32915154 |
atactaattaacagcaggaaaagaacagaagaacatgacaaaggtggttgtataaattattattgtttgttttgttcctttgtttgtttgtttgtttagg |
32915055 |
T |
 |
| Q |
113 |
acggaatgaacactttgctgtgtctgctttcagattttgatgttgttatacaattggaaaccactatctcgcgtcattatgataatgatgagataactaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32915054 |
acggaatgaacactttgctgtgtctgctttcagattttgatgttgttatacaattggaaaccactatctcgcgtcattatgataatgattagataactag |
32914955 |
T |
 |
| Q |
213 |
ccattgtgttgctagtggaaaagtgtcacatgtggtttatggtctctagcgatctatgaagcacatgtatgtaat |
287 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
32914954 |
ccattgtgttgctagtggaaaagtgttacatgtggtttattgtctctagcgatctatgaagcacatgtatctaat |
32914880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University