View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_low_92 (Length: 264)
Name: NF3892_low_92
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_low_92 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 3425467 - 3425214
Alignment:
| Q |
1 |
aacttgctacacaagttatctctgtgaatgacactaacttccttattttcatggtcaatacaaggcaacaatgacagaactcaaactcaaagatacggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3425467 |
aacttgctacacaagttatctctgtgaatgacactaacttccttattttcatggtcaatacaaggcaacaatgacagaactcaaactcaaagatacggta |
3425368 |
T |
|
| Q |
101 |
acaggatttttgagaatttttccctaaaattgcaatagcagacatcaaatcacaacggtaccgggatagcaccagcgccgcaatggcgctgctttttaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3425367 |
acaggatttttgagaatttttccctaaaattgcaatagcagatatcaaatcacaacggtaccgggatagcaccagcgccgcaatggcgctgctttttaac |
3425268 |
T |
|
| Q |
201 |
cactaatataggccgctagtgatgatactctcaatggcgcttttcgggcctatg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3425267 |
cactaatataggccgctagtgatgatactctcaatggcgcttttcgggcctatg |
3425214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University