View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_low_93 (Length: 264)
Name: NF3892_low_93
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_low_93 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 34 - 255
Target Start/End: Original strand, 49852254 - 49852475
Alignment:
| Q |
34 |
ctttggctctgctgctactatgatggtagactttcagaattagacatttatctccagattggcggtgccttctccagtgaaattgattttttcacaacct |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49852254 |
ctttggctctgctgctactatgatggtagactttcagaattagacatttatctccagattggcggtgccttctccagtgaaattgattttttcacaacct |
49852353 |
T |
|
| Q |
134 |
ttttctctactaccgaatcttcagacccttctttttctccttctctaccgaaaacttcaagttttccttcttttgatcttgacctacctttcaccacgtc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49852354 |
ttttctctactaccgaatcttcagacccttctttttctccttctctaccgaaaacttcaagttttccttcttttgatcttgacctacctttcaccacgtc |
49852453 |
T |
|
| Q |
234 |
ccgaattcaacaatccctatgc |
255 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49852454 |
ccgaattcaacaatccctatgc |
49852475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University