View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3892_low_99 (Length: 255)
Name: NF3892_low_99
Description: NF3892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3892_low_99 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 6 - 193
Target Start/End: Complemental strand, 32445505 - 32445321
Alignment:
| Q |
6 |
agcatcacagactacaaatgctcttttatttttatcatatctatcaaatgaataaatttgggaattgggattagacttaaactaagatagaattggattc |
105 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32445505 |
agcaacacatactacaaatgctcttttatttttatcatatctatcaaatgaataaatttgggaattgggattagacttaaactaagatagaattggattc |
32445406 |
T |
|
| Q |
106 |
ttcaaatctagcatatctcatgcggttgcattttttatttcacataccatctttttccttgtggattatagtgaagcagattttttct |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32445405 |
ttcaaatctagcatatctcatgcggttgcattttttatttcacataccatctttttccttgtgg---atagtgaagcagattttttct |
32445321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 193 - 240
Target Start/End: Complemental strand, 32445303 - 32445256
Alignment:
| Q |
193 |
taaggcatctgtgccgtccgattaaaattgtacgatcgagatcatttt |
240 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32445303 |
taaggcatatgtgccgtccaattaaaattgtacgatcgagatcatttt |
32445256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University