View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3895_high_10 (Length: 296)
Name: NF3895_high_10
Description: NF3895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3895_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 172 - 285
Target Start/End: Complemental strand, 2715374 - 2715266
Alignment:
| Q |
172 |
caatgaaacactaaatgtacttttccaactatatattcaacttttgttttgacaaatatcttcaaccataccattattaaatgataattttataaaaaga |
271 |
Q |
| |
|
|||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||||| || ||||||||||| |||||||||||||||| | |
|
|
| T |
2715374 |
caatgaaacattaaatgtacttttctaa-----tattcaacttttgttttgacaaatatcttcaactatgccattattaaaggataattttataaaaaaa |
2715280 |
T |
 |
| Q |
272 |
cttttaatttctct |
285 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
2715279 |
cttttaatttctct |
2715266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 141 - 185
Target Start/End: Complemental strand, 36065973 - 36065929
Alignment:
| Q |
141 |
ttgtttcaaattataggtcattttacgatatcaatgaaacactaa |
185 |
Q |
| |
|
|||| |||||||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
36065973 |
ttgtgtcaaattataagtcaatttacaatatcaatgaaacactaa |
36065929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 133 - 185
Target Start/End: Original strand, 14341787 - 14341839
Alignment:
| Q |
133 |
gaaaagatttgtttcaaattataggtcattttacgatatcaatgaaacactaa |
185 |
Q |
| |
|
||||| |||||| |||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
14341787 |
gaaaaaatttgtctcaaattatatgtcgctttacaatatcaatgaaacactaa |
14341839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University