View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3895_high_13 (Length: 253)
Name: NF3895_high_13
Description: NF3895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3895_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 123 - 237
Target Start/End: Complemental strand, 34403025 - 34402911
Alignment:
| Q |
123 |
ttaagaggtaaattttggtgacacacacgtgtggtggtggtgccatgattaggagtagaaattctcaaattgggtcttctccttctggaggtggggccca |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34403025 |
ttaagaggtaaattttggtgacacacacgtgtggtggtggtgccatgattaggagtagaaattctcaaattgggtcttctccttctggaggtggggccca |
34402926 |
T |
 |
| Q |
223 |
tgatatgaaaccaag |
237 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34402925 |
tgatatgaaaccaag |
34402911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 34403148 - 34403091
Alignment:
| Q |
1 |
ttccattttggtgaaagaggatatataataataataattgaaggaaccccagaagaaa |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34403148 |
ttccattttggtgaaagaggatatataataataataattgaaggaaccccagaagaaa |
34403091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University