View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3895_high_17 (Length: 241)
Name: NF3895_high_17
Description: NF3895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3895_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 37 - 223
Target Start/End: Original strand, 12156428 - 12156615
Alignment:
| Q |
37 |
gtaaaaataaacataacaaattagtcaagtttcatttctttatattgatatagacatagataaaagacaataacttacaaccagggtcttgtaaaaatct |
136 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |||| ||| ||||||| |
|
|
| T |
12156428 |
gtaaaaataaatataacaaattagtcaagtttcaattctttatattgatataggcatagataaaagacaataacttacaactagggcattggcaaaatct |
12156527 |
T |
 |
| Q |
137 |
ccctttgtcaatatcaagatacatttattagattccattggatca-ctacatagttggcatcctcaagctttgcaaggcaacaagcaa |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12156528 |
ccctttgtcaatatcaagatacatttattagattccattggatcaccaacatagttggcatcctcaagctttgcaaggtgacaagcaa |
12156615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University