View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3895_low_5 (Length: 417)
Name: NF3895_low_5
Description: NF3895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3895_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 2 - 401
Target Start/End: Complemental strand, 40025885 - 40025489
Alignment:
| Q |
2 |
gtggaggagcagagagaagatggttctgaaacagattttgaatctcttgataatagtcttaatgtgtcttcacccaatgaatcaagtgacacaatagaag |
101 |
Q |
| |
|
|||| ||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40025885 |
gtggtggaacagacagaagatgcttctgaaacagattttgaatctcttgataatagtcttaatgtgtcttcacccaatgaatcaagtgacacaatagaag |
40025786 |
T |
|
| Q |
102 |
ttaatcaagttgagaataaaatagcctcagaaactctagaagtggaattgaaggatgagaaaggagaagaagattgcaaatccattgaagatagtgatgg |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40025785 |
ttaatcaagttgagaataaaatggcctcagaaactctagaagtggaattgaaggatgagaaaggagaagaagattgcaaatccattgaagatc---atgg |
40025689 |
T |
|
| Q |
202 |
ggtggcacaaactgaattagctacttcaaaagacaataatgaaggatttaaggtaactgaagtggttgaaacagataaggacatgacagtagctgaagag |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40025688 |
ggtggcacaaactgaattagctacttcaaaagacaataatgaaggatttaaggtaactgaagtggttgaaacagataaggacatgacagtagctgaagag |
40025589 |
T |
|
| Q |
302 |
gagaatgttttgccttcaactgatgtggtttcaatttcaagggaagttgctttggagacaagtggtaaggggattgatgatggggatgcaaaggttgttc |
401 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40025588 |
gagaatgttttgccttcaactgatgtggtttcaatttcaagggaagttgctttggagacaagtggtaagggaattgatgatggggatgcaaaggttgttc |
40025489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University