View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3897_high_11 (Length: 219)
Name: NF3897_high_11
Description: NF3897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3897_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 203
Target Start/End: Original strand, 10584252 - 10584440
Alignment:
| Q |
15 |
catcaaagcaattaagtagttgcaaatttggtctataattgagcgatactatcaataatatctattgctatgtagtccctacattacagaaggacccttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
10584252 |
catcaaagcaattaagtagttgcaaatttggtctataattgagcgatactatcaataatatctattgctacgtagtccctacattatagaaggacccttt |
10584351 |
T |
|
| Q |
115 |
gaattaggtgcaacaatatcaataatctaaacgggaactatattacaaactcatgagtcattgttttgttcaatttgttgtatataaat |
203 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10584352 |
gaattaggtgtaacaatattaataatctaagcggcaactatattacaaactcatgagtcattgttttgttcaatttgttgtatataaat |
10584440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University